Gene name |
SPBC23E6.07c |
Gene ID |
29/G10 |
Gene synonyms/obsolete |
rfc1 |
Gene product |
replication factor C
(activator 1) subunit; activator of DNA polymerases; BRCT
domain; AAA family ATPase |
Entry clone |
Cloned |
ORF length (unspliced) |
2981 |
ORF length (spliced) |
2805 |
Entry clone length |
2981 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
827T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC23E6.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAATTCTGACATTCG |
Rev primer name |
SPBC23E6.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCTGTCTTTTTTCTGGAT |
Amino acid length |
934 |
Molecular weight |
103.4 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|