| Gene name |
SPAC26A3.12c |
| Gene ID |
29/G08 |
| Gene synonyms/obsolete |
dhp1 |
| Gene product |
5'-3' exoribonuclease;
involved in chromosome segregation; involved in RNA
processing; essential; functionally complements S.
cerevisiae RAT1; involved in meiotic recombination
(implicated) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2976 |
| ORF length (spliced) |
|
| Entry clone length |
2976 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC26A3.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTGTTCCAGCACTTTT |
| Rev primer name |
SPAC26A3.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATAGTAGCCATTCCTGTTA |
| Amino acid length |
991 |
| Molecular weight |
112.3 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
7/948 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDADLIMLGL/LPHLPSLDI/LPHMGGYLTL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|