| Gene name |
SPAC26H5.11 |
| Gene ID |
29/G06 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in spore wall
assembly; pleckstrin homology domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2948 |
| ORF length (spliced) |
2898 |
| Entry clone length |
2948 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
2506A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC26H5.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGAAGAAGACACGGA |
| Rev primer name |
SPAC26H5.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGAATGTCCGCGGTTAATT |
| Amino acid length |
965 |
| Molecular weight |
110.9 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSMLSKSLNL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
Confocal |