| Gene name |
SPCC736.11 |
| Gene ID |
29/F08 |
| Gene synonyms/obsolete |
|
| Gene product |
argonaute; involved in
RNA interference; involved in PTGS; involved in the regulation
of chromatin silencing at the centromere; involved in the
regulation of histone L9 methylation; functions upstream of
swi6; translation initiation factor eif-2c; Piwi domain; ZAP
domain; deletion mutant results in lagging chromosomes at
mitosis at reduced temperature (frequent); no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2876 |
| ORF length (spliced) |
2505 |
| Entry clone length |
2876 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC736.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTATAAACCAAGCTC |
| Rev primer name |
SPCC736.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATATACCACATCTTTGTT |
| Amino acid length |
834 |
| Molecular weight |
94.4 |
| Isoelectric point (calc.) |
9.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSIMFLDLLL/LGNVPTLIL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |