| Gene name |
SPAC1006.04c |
| Gene ID |
29/F06 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
sequence orphan; predicted coiled-coil |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2859 |
| ORF length (spliced) |
|
| Entry clone length |
2859 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1669G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1006.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTAAAGAAACTCACGA |
| Rev primer name |
SPAC1006.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTGTCTCCAAATGTTTGC |
| Amino acid length |
952 |
| Molecular weight |
109.8 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCSLVEELKL/LEKVNSELKL |
| Localization (YFP) |
cytoplasmic dots;
mitochondrion |
| Comments for localization |
large bright dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |