| Gene name |
SPBC16H5.02 |
| Gene ID |
29/E09 |
| Gene synonyms/obsolete |
pfk1 |
| Gene product |
6-phosphofructokinase;
overexpression results in cell cycle defects; involved in
glycolysis; 6-phosphofructokinase activity; Sp appears to only
have one isoform, most other yeasts have 2, is this in one of
the gaps? |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2829 |
| ORF length (spliced) |
|
| Entry clone length |
2829 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2723T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16H5.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGGAGAAACCGTGCA |
| Rev primer name |
SPBC16H5.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCAGCAAAGGTCTTGCCG |
| Amino acid length |
942 |
| Molecular weight |
102.5 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
large bright dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |