Gene name |
SPBC16H5.02 |
Gene ID |
29/E09 |
Gene synonyms/obsolete |
pfk1 |
Gene product |
6-phosphofructokinase;
overexpression results in cell cycle defects; involved in
glycolysis; 6-phosphofructokinase activity; Sp appears to only
have one isoform, most other yeasts have 2, is this in one of
the gaps? |
Entry clone |
Cloned |
ORF length (unspliced) |
2829 |
ORF length (spliced) |
|
Entry clone length |
2829 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
2723T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC16H5.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGGAGAAACCGTGCA |
Rev primer name |
SPBC16H5.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCAGCAAAGGTCTTGCCG |
Amino acid length |
942 |
Molecular weight |
102.5 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
large bright dots by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |