| Gene name |
SPBC25H2.03 |
| Gene ID |
29/E07 |
| Gene synonyms/obsolete |
|
| Gene product |
HEAT repeat; involved
in phospholipid metabolism; involved in vacuole inheritance;
involved in stress-induced increase of phosphatidylinositol
3,5-bisphosphate |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2823 |
| ORF length (spliced) |
2436 |
| Entry clone length |
2823 |
| No. of intron |
7 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC25H2.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAATTTACGACTTTA |
| Rev primer name |
SPBC25H2.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGTTTTGGCTTCTTTCTC |
| Amino acid length |
811 |
| Molecular weight |
92.4 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
587 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCALEWVLLL/LHKALYGILML |
| Localization (YFP) |
cytoplasmic dots,
especially at cell tip and site of septum formation;
cytosol |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |