| Gene name |
SPAC57A7.10c |
| Gene ID |
29/E05 |
| Gene synonyms/obsolete |
sec21 |
| Gene product |
adaptin; coatomer
(gamma subunit); the coatomer is a cytosolic protein complex
that binds to dilysine motifs and reversibly associates with
Golgi non- clathrin-coated vesicles, which further mediate
biosynthetic protein transport from the ER, via the Golgi up
to the trans Golgi network; coatomer complex is required for
budding from Golgi membranes, and is essential for the
retrograde Golgi-to-ER transport of dilysine-tagged proteins
(By similarity); the COPG family |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2821 |
| ORF length (spliced) |
2718 |
| Entry clone length |
2821 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
4A:G / 1856T:C /
2489T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC57A7.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTATTCTAAAAAAGA |
| Rev primer name |
SPAC57A7.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCAATTCCTCCAACTACC |
| Amino acid length |
905 |
| Molecular weight |
100.9 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQPVVSVLKI/LPALERSLVI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |