| Gene name |
SPAC24B11.10c |
| Gene ID |
29/D12 |
| Gene synonyms/obsolete |
|
| Gene product |
Chs Four Homologue
(pers. comm. Henar Montero); involved in chitin biosynthesis;
SEL1 repeat protein; similar to Sp SPBC1289.01C and
SPCC417.05C and SPBC3E7.12C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2799 |
| ORF length (spliced) |
|
| Entry clone length |
2799 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
734A:G / 2682A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC24B11.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGATTCACATAGCTC |
| Rev primer name |
SPAC24B11.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATTACGACACACTGCTCT |
| Amino acid length |
932 |
| Molecular weight |
103.1 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; periphery at cell
tip and site of septum formation; cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |