| Gene name |
SPAC11G7.02 |
| Gene ID |
29/D01 |
| Gene synonyms/obsolete |
pub1 |
| Gene product |
ubiquitin-protein
ligase (E3); WW domain; HECT domain; C2 domain; WW domains are
predicted to interact directly with the carboxyl-terminal
domain of RNA polymerase II; involved in endocytosis; function
partially overlapping with Pub2p; negatively regulates leucine
uptake in response to NH(4)(+); similar to Sp SPBC16E9.11C and
SPAC1805.15C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2548 |
| ORF length (spliced) |
2304 |
| Entry clone length |
2548 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1133A:G /
1249T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC11G7.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAACTCAGCTCAGTA |
| Rev primer name |
SPAC11G7.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCCTGACCAAAACCAATC |
| Amino acid length |
767 |
| Molecular weight |
87.2 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDNDITGVLDL |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |