| Gene name |
SPBC582.10c |
| Gene ID |
29/C11 |
| Gene synonyms/obsolete |
|
| Gene product |
DEAD/DEAH box
helicase; involved in nucleotide-excision repair; involved in
DNA repair; SNF2 familyhelicase; C-terminal domain;
non-essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2545 |
| ORF length (spliced) |
2493 |
| Entry clone length |
2545 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
415T:C / 791T:C /
2018T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC582.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAAAGCGTCTAAAAA |
| Rev primer name |
SPBC582.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCCGCGGCACGCTTGTTA |
| Amino acid length |
830 |
| Molecular weight |
93.9 |
| Isoelectric point (calc.) |
9.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYSLVKFLHI |
| Localization (YFP) |
cytosol; a few
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |