| Gene name |
SPAC139.01c |
| Gene ID |
29/B05 |
| Gene synonyms/obsolete |
SPAC955.02c |
| Gene product |
XP-G family; involved
in nucleotide-excision repair; involved in DNA repair |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2510 |
| ORF length (spliced) |
2409 |
| Entry clone length |
2510 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
514r:a / 1346T:C /
1368T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC139.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAAGTAAGTTAAAATA |
| Rev primer name |
SPAC139.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAGCCAAGAGAAAATATC |
| Amino acid length |
802 |
| Molecular weight |
90.1 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAKVATFLPI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |