| Gene name |
SPAC23C4.17 |
| Gene ID |
28/B11 |
| Gene synonyms/obsolete |
|
| Gene product |
methyltransferase;
NOL1/NOP2/sun family; involved in methylation of cytidine to
5-methyl-cytidine (m5C) at several positions in different
tRNAs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2280 |
| ORF length (spliced) |
2025 |
| Entry clone length |
2280 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23C4.17.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAAAAGAAATAAAAA |
| Rev primer name |
SPAC23C4.17.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGCTTCTCTTTTCTAGCA |
| Amino acid length |
674 |
| Molecular weight |
76.6 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKSVEGLVI/LRILIRGLQL/LVDVSKKLPL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica;
DeltaVision |