Gene name |
SPAPYUG7.03c |
Gene ID |
28/A03 |
Gene synonyms/obsolete |
mid2 |
Gene product |
pleckstrin homology
domain; involved in cytokinesis; involved in septation;
involved in cytokinesis, formation of actomyosin apparatus;
involved in cell separation; GTP-binding protein (ISS) |
Entry clone |
Cloned |
ORF length (unspliced) |
2115 |
ORF length (spliced) |
|
Entry clone length |
2115 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
332T:C / 935T:C /
1472T:C / 2046T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPYUG7.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGCTTCTCAACAGGA |
Rev primer name |
SPAPYUG7.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAACTCAGCGAAAGAAAT |
Amino acid length |
704 |
Molecular weight |
78.7 |
Isoelectric point (calc.) |
5.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LADIHRALRI/LMEIRNLTI/LPRKVGELEI |
Localization (YFP) |
periphery at site of
septum formation; cytosol; cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol; cytoplasmic dots |
Microscope used for
observation |
Leica |