| Gene name |
SPAC4D7.03 |
| Gene ID |
27/H09 |
| Gene synonyms/obsolete |
sud1; pop2 |
| Gene product |
F-box protein; WD
repeat protein; ubiquitin ligase complex |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2112 |
| ORF length (spliced) |
|
| Entry clone length |
2112 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
912T:C / 1102T:C /
1764T:C / 2012T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4D7.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCACTCTCTAGGTGTCC |
| Rev primer name |
SPAC4D7.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGGTCTTGATCCGGAAAAA |
| Amino acid length |
703 |
| Molecular weight |
79.6 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|