| Gene name |
SPCC63.03 |
| Gene ID |
27/H05 |
| Gene synonyms/obsolete |
|
| Gene product |
DNAJ domain protein;
no Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2097 |
| ORF length (spliced) |
1929 |
| Entry clone length |
2097 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
231A:G / 278A:G /
980A:C / 1253A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC63.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGAAGCGGATTCTTG |
| Rev primer name |
SPCC63.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGAAAATGTAAACAATGA |
| Amino acid length |
642 |
| Molecular weight |
72.2 |
| Isoelectric point (calc.) |
9.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
489 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|