| Gene name |
SPAC1D4.11c |
| Gene ID |
27/G02 |
| Gene synonyms/obsolete |
lkh1 |
| Gene product |
dual specificity
protein kinase; regulates the cell surface formation, septum
formation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1728 |
| ORF length (spliced) |
|
| Entry clone length |
1728 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
ORF prediction was
changed (shortened). |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1D4.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTCAGTCTCCTACATC |
| Rev primer name |
SPAC1D4.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAATTTGAAGAAATTGGT |
| Amino acid length |
575 |
| Molecular weight |
65 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss;
DeltaVision |