| Gene name |
SPCC74.03c |
| Gene ID |
27/F02 |
| Gene synonyms/obsolete |
|
| Gene product |
serine/threonine
protein kinase; involved in the regulation of carbohydrate
metabolism; similar to Sp SPAC23H4.02 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2041 |
| ORF length (spliced) |
1731 |
| Entry clone length |
2041 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1426A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC74.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAACCGCAGGAGGTTGA |
| Rev primer name |
SPCC74.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCAGAAAATAACTTGCAC |
| Amino acid length |
576 |
| Molecular weight |
65.9 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKSSFPFLDL |
| Localization (YFP) |
SPB?; cytosol=nucleus;
cytoplasmic dots |
| Comments for localization |
SPB on abnormal
spindle? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |