| Gene name |
SPCC1682.05c |
| Gene ID |
27/B11 |
| Gene synonyms/obsolete |
|
| Gene product |
TPR repeat protein;
localization signal recognition particle; involved in
protein-ER targeting |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1970 |
| ORF length (spliced) |
1794 |
| Entry clone length |
1970 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
460A:G / 972A:G /
1748T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1682.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACCCGCATGTTAAGCT |
| Rev primer name |
SPCC1682.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCGTCCAAGCAAACTGCTA |
| Amino acid length |
597 |
| Molecular weight |
67.8 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAYNVVLLRI |
| Localization (YFP) |
cytosol; ambiguous
structure |
| Comments for localization |
nuclear envelope?,
periphery? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|