| Gene name |
SPBC16H5.08c |
| Gene ID |
27/B09 |
| Gene synonyms/obsolete |
|
| Gene product |
non-transporter with
ATP binding cassette |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1969 |
| ORF length (spliced) |
1857 |
| Entry clone length |
1969 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
740A:G / 1274A:G /
1440T:C / 1487T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16H5.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTCCAAATCAGCGTC |
| Rev primer name |
SPBC16H5.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATCAAATGCTTAACTTTG |
| Amino acid length |
618 |
| Molecular weight |
69.2 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLNLITGLLI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |