| Gene name |
SPCC1322.08 |
| Gene ID |
27/B03 |
| Gene synonyms/obsolete |
srk1 |
| Gene product |
MAPK-activated protein
kinase; involved in osmotic stress; meiotic regulator;
interacts physically with Sty1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1966 |
| ORF length (spliced) |
1743 |
| Entry clone length |
1966 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1322.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTTTTAAAGTATGTTT |
| Rev primer name |
SPCC1322.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACACTTTTTGTCGATGTCGA |
| Amino acid length |
580 |
| Molecular weight |
66.1 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|