| Gene name |
SPBC25B2.03 |
| Gene ID |
26/H09 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-C2H2 type |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1944 |
| ORF length (spliced) |
1665 |
| Entry clone length |
1944 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
448C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC25B2.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAATACAATTGGGAA |
| Rev primer name |
SPBC25B2.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGACCTCTTTCGAGTTCA |
| Amino acid length |
554 |
| Molecular weight |
61.8 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LANVEQLML |
| Localization (YFP) |
periphery; ER?;
Golgi?; vacuole membrane |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |