| Gene name |
SPBC1778.02 |
| Gene ID |
26/G09 |
| Gene synonyms/obsolete |
rap1 |
| Gene product |
involved in telomere
maintenance; involved in mating-type silencing; Myb family;
DNA binding protein; telomere binding is essential for
meiosis; BRCT domain; interacts physically with Taz1p;
recruited to the telomere by Taz1p (implicated); involved in
telomeric silencing (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2211 |
| ORF length (spliced) |
2082 |
| Entry clone length |
2211 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
ORF prediction was
changed (extended). |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1778.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATTTACATTCACCAA |
| Rev primer name |
SPBC1778.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAAGTTTGTTTTGAAAGT |
| Amino acid length |
693 |
| Molecular weight |
79.5 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |