| Gene name |
SPBC1773.01 |
| Gene ID |
26/G05 |
| Gene synonyms/obsolete |
|
| Gene product |
WD repeat protein;
striatin; involved in cell cycle progression; human ortholog
is expressed mainly in S and G phase; possibly binds
calmodulin |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1920 |
| ORF length (spliced) |
1839 |
| Entry clone length |
1920 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1140C:T / 1393C:T /
1530T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1773.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATCCAACCTATCATT |
| Rev primer name |
SPBC1773.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGGTAAATATTTGCGGTCG |
| Amino acid length |
612 |
| Molecular weight |
69.4 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
bright large dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |