| Gene name |
SPAC15A10.06 |
| Gene ID |
26/E07 |
| Gene synonyms/obsolete |
|
| Gene product |
CPA1 sodium ion/proton
antiporter |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1896 |
| ORF length (spliced) |
1710 |
| Entry clone length |
1896 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC15A10.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAGATTCTAAGCATTG |
| Rev primer name |
SPAC15A10.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTTTGTTCCATTTTTA |
| Amino acid length |
569 |
| Molecular weight |
63.9 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
13 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFILLVLLI/LIIRVSPGLII/LVVVVLTLII |
| Localization (YFP) |
Golgi; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |