| Gene name |
SPAC26A3.15c |
| Gene ID |
26/C06 |
| Gene synonyms/obsolete |
|
| Gene product |
nucleoporin; nuclear
pore complex; involved in nuclear export; involved in nuclear
import |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1863 |
| ORF length (spliced) |
1797 |
| Entry clone length |
1863 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
384A:G / 937A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC26A3.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGTAAGTGTAAGAGGCG |
| Rev primer name |
SPAC26A3.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAACAAAACGTCAGAATTC |
| Amino acid length |
598 |
| Molecular weight |
60.7 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear envelope |
| Comments for localization |
large dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |