| Gene name |
SPBC1198.11c |
| Gene ID |
25/G05 |
| Gene synonyms/obsolete |
reb1;
SPBC660.01c |
| Gene product |
DNA binding
termination factor for RNA polymerase I transcription; Myb
family; DNA binding protein; sequence specific recognition
site AGGTAAGGGTAATGCAC in the rDNA intergenic spacer; similar
to Sp SPAC22F8.07c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1607 |
| ORF length (spliced) |
1515 |
| Entry clone length |
1607 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
474G:A / 1088T:A /
1297A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1198.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATACCTCCGTATTAAA |
| Rev primer name |
SPBC1198.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTGGAGAATCCAGAAAGT |
| Amino acid length |
504 |
| Molecular weight |
58.4 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |