| Gene name |
SPCC1672.09 |
| Gene ID |
25/G03 |
| Gene synonyms/obsolete |
|
| Gene product |
triglyceride
lipase-cholesterol esterase; similar to Sp SPBC16A3.12C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1603 |
| ORF length (spliced) |
1404 |
| Entry clone length |
1603 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
145T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1672.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTCAGTTACCGTTTAT |
| Rev primer name |
SPCC1672.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATTGGTTTATTCCTAGGA |
| Amino acid length |
467 |
| Molecular weight |
54.3 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
59 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAFMIHNTLGL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |