Gene name |
SPCC553.01c |
Gene ID |
25/C07 |
Gene synonyms/obsolete |
SPCC736.01c |
Gene product |
conserved
hypothetical; hypothetical protein; possibly involved in
signal transduction, as the only detectable defect of the null
mutant of the S. cerevisiae homolog YGR042w is in
heterologous signal transduction |
Entry clone |
Cloned |
ORF length (unspliced) |
2148 |
ORF length (spliced) |
|
Entry clone length |
2148 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1672T:C /
1807T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC553.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATACAAGTTCCAATGT |
Rev primer name |
SPCC553.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATAAAGTCACCATCTTCG |
Amino acid length |
715 |
Molecular weight |
78 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; nuclear
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |