| Gene name |
SPBC14F5.12c |
| Gene ID |
25/A11 |
| Gene synonyms/obsolete |
|
| Gene product |
DNA-binding protein;
centromere binding protein; involved in chromosome
segregation; CENP-B homolog; CENP-B box; C-terminal
dimerization domain; disruption of CENP-B homologs causes a
decrease in heterochromatin-specific modifications of histone
H3; Sp CENP-B homologs are functionally redundant at
centromeres; CENP-B homologs act as site-specific nucleation
factors for the formation of centromeric heterochromatin by
heterochromatin-specific modifications of histone tails |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1545 |
| ORF length (spliced) |
|
| Entry clone length |
1545 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC14F5.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTCCATTGAGGCGTCA |
| Rev primer name |
SPBC14F5.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACACAATCGATCTGCTTTCT |
| Amino acid length |
514 |
| Molecular weight |
59.6 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
aggregates with strong
signal by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |