| Gene name |
SPAC26A3.02 |
| Gene ID |
24/G10 |
| Gene synonyms/obsolete |
myh1; myh |
| Gene product |
MutY homolog; involved
in mismatch repair; interacts physically with Pcn1p; adenine
DNA glycosylase; A/8-oxoG glycosylase; deletion mutant has
mutator phenotype; oxidative DNA damage protection; no
apparent Sc ortholog (old-> A/G-specific adenine DNA
glycosylase) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1528 |
| ORF length (spliced) |
1386 |
| Entry clone length |
1528 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC26A3.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGATTCAAATCATTC |
| Rev primer name |
SPAC26A3.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCACTCTGCTTTCGTTACA |
| Amino acid length |
461 |
| Molecular weight |
52.9 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |