| Gene name |
SPBC800.08 |
| Gene ID |
24/G06 |
| Gene synonyms/obsolete |
|
| Gene product |
eukaryotic translation
initiation factor 3 gamma subunit; involved in
1-methyladenosine modification and maturation of initiator
methionyl-tRNA; RNA-binding protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1525 |
| ORF length (spliced) |
1389 |
| Entry clone length |
1525 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
852A:G / 1260A:G /
1345A:C / 1407T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC800.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGAGGCATGCATCAAC |
| Rev primer name |
SPBC800.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTCCAATTTTGCTTTT |
| Amino acid length |
462 |
| Molecular weight |
53.2 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQHLLPKLGI |
| Localization (YFP) |
nucleus |
| Comments for localization |
one nuclear dot by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |