| Gene name |
SPAC1039.04 |
| Gene ID |
24/G02 |
| Gene synonyms/obsolete |
|
| Gene product |
membrane transporter;
unknown specificity; similar to Sp SPAC11D3.18C and
SPAC1683.12 and SPAC1002.16C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1524 |
| ORF length (spliced) |
|
| Entry clone length |
1524 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
226A:G / 864T:C /
1094T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1039.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGAAATCTATATCATC |
| Rev primer name |
SPAC1039.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAGAAACCATCTAAAATTT |
| Amino acid length |
507 |
| Molecular weight |
56 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPLLALLYL/LCAIVIFLVL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |