Gene name |
SPBP8B7.17c |
Gene ID |
24/F08 |
Gene synonyms/obsolete |
|
Gene product |
TENA/THI domain;
similar to Sp SPBP8B7.18C and SPCC18B5.05C (paralogs); tandem
duplication in pB8B7 |
Entry clone |
Cloned |
ORF length (unspliced) |
1521 |
ORF length (spliced) |
|
Entry clone length |
1521 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
568T:C / 1235G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP8B7.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTTCGACTTGTATCAC |
Rev primer name |
SPBP8B7.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAACACAGATGATTCGTTA |
Amino acid length |
506 |
Molecular weight |
55.7 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLVMPDYLEL/LIPNIAEALII/LSSAVASNLAI/LSKVQHLLGI |
Localization (YFP) |
cytosol=nucleus;
cytoplasmic dots |
Comments for localization |
one nuclear dot |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |