| Gene name |
SPAC328.02 |
| Gene ID |
24/E09 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); TRIAD
composite zinc finger domain; Ariadne-2-like (which is a
ubiquitin conjugating enzyme e2-binding protein); IBR domain
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1515 |
| ORF length (spliced) |
|
| Entry clone length |
1515 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1324C:T / 1482A:G /
1488C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC328.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGACCTATTGGACGA |
| Rev primer name |
SPAC328.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACACATCAACAACATATTCC |
| Amino acid length |
504 |
| Molecular weight |
58.9 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
42 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |