| Gene name |
SPAC8C9.03 |
| Gene ID |
24/D06 |
| Gene synonyms/obsolete |
cgs1; rak1 |
| Gene product |
cAMP-dependent protein
kinase; negative regulator of meiosis; mutant (cgs1-1)
displays cAPK activity unregulated by cyclic AMP (cAMP);
(old-> cAMP-dependent protein kinase regulatory
chain) |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1504 |
| ORF length (spliced) |
1239 |
| Entry clone length |
1504 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC8C9.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTCGAAGAAGTATA |
| Rev primer name |
SPAC8C9.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCTTTAGTTGATGGAGGT |
| Amino acid length |
412 |
| Molecular weight |
46.4 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>=cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |