| Gene name |
SPCC970.02 |
| Gene ID |
24/C06 |
| Gene synonyms/obsolete |
|
| Gene product |
glycosyl hydrolase
family; alpha-1,6-mannanase; similar to Sp SPAC3C7.05c; GPI
anchored protein; glycoprotein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1498 |
| ORF length (spliced) |
1329 |
| Entry clone length |
1498 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
788A:G / 1071A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC970.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTCTTACAATCTTTAT |
| Rev primer name |
SPCC970.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTAAAGGACCAGTGTAGGC |
| Amino acid length |
442 |
| Molecular weight |
49.1 |
| Isoelectric point (calc.) |
4.2 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEAIQAPLLL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |