| Gene name |
SPBC28F2.01c |
| Gene ID |
23/G03 |
| Gene synonyms/obsolete |
SPBC27.08c |
| Gene product |
sulfate
adenylyltransferase; ATP sulfurylase; involved in methionine
biosynthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1473 |
| ORF length (spliced) |
|
| Entry clone length |
1473 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
191T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC28F2.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTAAAGCTTTGTTGAA |
| Rev primer name |
SPBC28F2.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGATAGCCTTCGTCAGAC |
| Amino acid length |
490 |
| Molecular weight |
54.7 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
DeltaVision |