| Gene name |
SPAC3G9.13c |
| Gene ID |
23/E04 |
| Gene synonyms/obsolete |
|
| Gene product |
tryptophan-tRNA
ligase; involved in tryptophanyl-tRNA aminoacylation;
tryptophan-tRNA ligase activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1457 |
| ORF length (spliced) |
1086 |
| Entry clone length |
1457 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
12T:A / 78T:C /
878T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3G9.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTAAACTTCCAAAAAT |
| Rev primer name |
SPAC3G9.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTATACGCTCAAACCTGTT |
| Amino acid length |
361 |
| Molecular weight |
39.8 |
| Isoelectric point (calc.) |
9.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDMLAALLAI |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
aggregates |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |