| Gene name |
SPBC1604.18c |
| Gene ID |
23/D10 |
| Gene synonyms/obsolete |
|
| Gene product |
SNF7 family; involved
in intracellular protein transport; class E vps |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1454 |
| ORF length (spliced) |
1350 |
| Entry clone length |
1454 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1430T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1604.18.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAAAAAGGAGAAAGT |
| Rev primer name |
SPBC1604.18.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGCTCAACCAGCTCAGCT |
| Amino acid length |
449 |
| Molecular weight |
50.7 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYSDFTSLFI/LERKVSSRLQL |
| Localization (YFP) |
cytoplasmic dots;
ambiguous structure |
| Comments for localization |
short membranous
structure; aggregates by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |