Gene name |
SPAP8A3.11c |
Gene ID |
23/A02 |
Gene synonyms/obsolete |
|
Gene product |
GTP1/OBG family;
GTP-binding protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1319 |
ORF length (spliced) |
1260 |
Entry clone length |
1319 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
822T:C / 1177A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAP8A3.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTTCATTGAGAACATC |
Rev primer name |
SPAP8A3.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACGAGTAATCGTTGTTGG |
Amino acid length |
419 |
Molecular weight |
45.4 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |