| Gene name |
SPBC660.02 |
| Gene ID |
22/H02 |
| Gene synonyms/obsolete |
mfr1;
SPBC1198.12 |
| Gene product |
WD repeat protein;
meiosis-specific activator of APC; coordinates meiotic nuclear
division with sporulation; fizzy-related |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1312 |
| ORF length (spliced) |
1266 |
| Entry clone length |
1312 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
178A:G / 307T:C /
867T:C / 1085T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC660.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAGACCGATTCATTCC |
| Rev primer name |
SPBC660.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGAATTAATGTACTTTCT |
| Amino acid length |
421 |
| Molecular weight |
47.2 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |