| Gene name |
SPBC17G9.05 |
| Gene ID |
22/E11 |
| Gene synonyms/obsolete |
cyp6 |
| Gene product |
cyclophilin;
peptidyl-prolyl cis-trans isomerase; CRIP family; P.
tetraurelia ortholog is involved in cell morphogenesis; no
apparent Sc ortholog; RNA-binding protein; rrm RNA recognition
motif |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1299 |
| ORF length (spliced) |
|
| Entry clone length |
1299 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
492A:G / 984A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC17G9.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGTACTAATTGAAAC |
| Rev primer name |
SPBC17G9.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCGATATCTATCATCTCTA |
| Amino acid length |
432 |
| Molecular weight |
50.7 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |