| Gene name |
SPAC227.11c |
| Gene ID |
22/B09 |
| Gene synonyms/obsolete |
|
| Gene product |
membrane-associated
glycoprotein; involved in intracellular protein transport;
involved in ER to golgi transport; involved in the transport
of GPI-anchored proteins to the Golgi apparatus |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1226 |
| ORF length (spliced) |
969 |
| Entry clone length |
1226 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
765A:G / 1012A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC227.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTCCACATTTGATTCT |
| Rev primer name |
SPAC227.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACAGAGGAACAGGGATAG |
| Amino acid length |
322 |
| Molecular weight |
36.7 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |