| Gene name |
SPAPJ696.02 |
| Gene ID |
22/A06 |
| Gene synonyms/obsolete |
|
| Gene product |
actin cortical patch
component; involved in actin cytoskeletal organization;
involved in endocytosis; src (SH3) homology domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1432 |
| ORF length (spliced) |
1293 |
| Entry clone length |
1432 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
664A:G / 1375T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPJ696.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTCTTCATAACCCTTT |
| Rev primer name |
SPAPJ696.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGACAATTTTACATAGTTA |
| Amino acid length |
430 |
| Molecular weight |
46.3 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no transformant |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|