| Gene name |
SPAC23A1.10 |
| Gene ID |
21/D07 |
| Gene synonyms/obsolete |
ef1a-b; tef1-b;
tef1-d; ef1a-d |
| Gene product |
elongation factor 1
(alpha 2 subunit); similar to Sp SPBC839.15C and
SPCC794.09C |
| Entry clone |
Cloned
(Re-cloned) |
| ORF length (unspliced) |
1383 |
| ORF length (spliced) |
|
| Entry clone length |
1383 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC23A1.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCAAAGAAAAGGGACA |
| Rev primer name |
SPAC23A1.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTCTTGGCACCAGCCTTA |
| Amino acid length |
460 |
| Molecular weight |
49.6 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |