Gene name |
SPAC1420.03 |
Gene ID |
21/D01 |
Gene synonyms/obsolete |
rpn5-a |
Gene product |
19S proteasome
regulatory subunit; Non-ATPase subunit; PCI domain; duplicated
in Sp; similar to Sp rpn502 |
Entry clone |
Cloned |
ORF length (unspliced) |
1379 |
ORF length (spliced) |
1332 |
Entry clone length |
1379 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
1025T:C /
1178T:C |
Comments |
Identical to
SPAPB8E5.02c |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1420.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACAGAAACCGGAAGT |
Rev primer name |
SPAC1420.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTGGCTACCGCCTGTTGA |
Amino acid length |
443 |
Molecular weight |
51.6 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEKVRQLII |
Localization (YFP) |
nuclear envelope;
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |