Gene name |
SPAC1783.04c |
Gene ID |
21/C06 |
Gene synonyms/obsolete |
hst4 |
Gene product |
Sir2p family;
transcriptional regulator; histone deacetylase activity;
NAD-dependent histone deacetylase activity; involved in
chromatin silencing; involved in centromere function; involved
in chromatin assembly/disassembly; involved in transcriptional
regulation |
Entry clone |
Cloned |
ORF length (unspliced) |
1373 |
ORF length (spliced) |
1248 |
Entry clone length |
1373 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
261A:G / 427T:C /
1312T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1783.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGTGGAGGAGCACGT |
Rev primer name |
SPAC1783.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGCGGAGAAGGGGTTGCA |
Amino acid length |
415 |
Molecular weight |
46.5 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |