Gene name |
SPBC3E7.12c |
Gene ID |
21/C04 |
Gene synonyms/obsolete |
|
Gene product |
Chs Four Homologue
(pers. comm. Henar Montero); chitin synthase regulatory
factor; SEL1 repeat protein; similar to Sp SPBC1289.01C and
SPAC24B11.10c and SPCC417.05c |
Entry clone |
Cloned |
ORF length (unspliced) |
1371 |
ORF length (spliced) |
|
Entry clone length |
1371 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1265A:C /
1276T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3E7.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTGCATCCACGTCCAT |
Rev primer name |
SPBC3E7.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTGGAGGAGAACCAAGGTA |
Amino acid length |
456 |
Molecular weight |
49.5 |
Isoelectric point (calc.) |
6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |