Gene name |
SPAC6F6.12 |
Gene ID |
21/B04 |
Gene synonyms/obsolete |
|
Gene product |
sorting nexin;
involved in proteasome function; similar to Sp SPBC1711.11; PX
domain; phosphoinositide binding; involved in intracellular
protein transport |
Entry clone |
Cloned |
ORF length (unspliced) |
1362 |
ORF length (spliced) |
1206 |
Entry clone length |
1362 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
314T:C / 668A:G /
1131T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC6F6.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGATTCTGTGAATTT |
Rev primer name |
SPAC6F6.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGCTTAACACGTATCCAA |
Amino acid length |
401 |
Molecular weight |
46.3 |
Isoelectric point (calc.) |
6.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEGSIQKLLRL |
Localization (YFP) |
Golgi |
Comments for localization |
large cytoplasmic dots
by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |